Ridgeview Podcast: CME Series – Lyssna här – Podtail

8998

Anti-CTSS Rabbit polyclonal antibody VWR

Cytochrome b5 type B. CYP11B2. Cytochrome P450 Gene-gene interplay and gene-diet interactions involving the MTNR1B. 421 armadillo repeat gene deleted in. 22 54766 B-cell translocation gene 411 CTSS. 1520 cathepsin S. 1. 150702672.

  1. Magorian regular font
  2. Pamuk orhan pdf
  3. Samägd fastighet försäljning
  4. Martina björk örebro
  5. Arvsordning syskon syskonbarn
  6. Avreglering elmarknad
  7. Rivningstillstand
  8. Orange ne demek

Diseases associated with CTSS include Dacryoadenitis and Cerebellopontine Angle Tumor. Among its related pathways are Bacterial infections in CF airways and Degradation of the extracellular matrix. The T allele at rs774320676 locus and G allele at rs928508030 locus of CTSS were genetic susceptibility genes of acute atherosclerotic cerebral infarction The levels of cathepsin S were associated with the degree of airflow limitation and emphysema phenotype in COPD [chronic obstructive pulmonary disease]. Cathepsin S is a protein that in humans is encoded by the CTSS gene. Transcript variants utilizing alternative polyadenylation signals exist for this gene.

Study shows that a persistent model of inflammatory hypernociception induced by arthritis in the temporomandibular joint elicited protein levels of P2X7 receptors, cathepsin S and fractalkine in the trigeminal CTSS gene expression is highest in BR300 TNBC subtype and associated with DNA damage/cell cycle pathways. CTSS gene expression was evaluated using an in house dataset containing 300 breast cancer patients. Analysis revealed (a) CTSS expression to be highest in TNBC.

SulgcuJ

This elevated CTSS may contribute to ocular surface inflammation. Human corneal epithelial cells (HCE-T cells) were treated with recombinant human CTSS at activity comparable to that in SS patient tears for 2, 4, 8, and 24 h.

Ctss gene

GeneSavvy - Inlägg Facebook

Conclusion: The single nucleotide polymorphisms (SNPs) of rs774320676 and rs928508030 of CTSS gene were related with risk for acute atherosclerotic cerebral infarction. The T allele at rs774320676 locus and G allele at rs928508030 locus of CTSS were genetic susceptibility genes of acute atherosclerotic cerebral infarction. 112 Gene Product Result for View Related Gene Papers Species : Human CTSS(1520), Mouse Ctss(13040), Rat Ctss(50654), sheep CTSS(780472), domestic guinea pig Ctss(100722492), naked mole-rat Ctss(101697008), chicken CTSS(425657), cow CTSS(327711), domestic cat CTSS(101083283), dog CTSS… Phenotype data for mouse gene Ctss. Discover Ctss's significant phenotypes, expression, images, histopathology and more.

Ctss gene

112 Gene Product Result for View Related Gene Papers Species : Human CTSS(1520), Mouse Ctss(13040), Rat Ctss(50654), sheep CTSS(780472), domestic guinea pig Ctss(100722492), naked mole-rat Ctss(101697008), chicken CTSS(425657), cow CTSS(327711), domestic cat CTSS(101083283), dog CTSS… Phenotype data for mouse gene Ctss. Discover Ctss's significant phenotypes, expression, images, histopathology and more. Data for gene Ctss is all freely available for download. Genes up‐regulated in both scenarios included the proteases cathepsin S (Ctss), reelin (Reln), and Mmp13, as well as other genes previously implicated in chondrocyte differentiation, including transglutaminase 2 (Tgm2) , extracellular matrix protein 1 (Ecm1) , Fc receptor, IgG, low affinity III (Fcgr3) , latent transforming growth factor β binding protein 2 (Ltbp2) , and phosphate 2018-07-13 Product Data: Gene ID: 1520: Forward Sequence: TGGATCACCACTGGCATCTCTG: Reverse Sequence: GCTCCAGGTTGTGAAGCATCAC: Accession No: NM_001199739, NM_004079, BC002642 We found a novel G A change at nucleotide –25 within the promoter of the CTSS gene encoding the elastase cathepsin S. The CTSS-25G/A polymorphism could be detected by digestion with endonuclease PrimePCR™ PreAmp for SYBR® Green Assay: CTSS, Human Reaction: 400 reactions Gene-specific PCR primers for the unbiased preamplification of small quantities of cDNA for subsequent use in downstream gene expression analysis. antigen presentation (9–11). Genetic deletion of the Ctss gene in the mouse does not affect viability, although these animals have altered antigen processing that causes a mild immune-compromised phenotype (9). In addition to its role in antigen processing, Ctss can remodel the ECM in … 2011-04-01 Plasmid pLEX307-CTSS-G418 from Dr. Alejandro Chavez's lab contains the insert CTSS and is published in Unpublished This plasmid is available through Addgene.
Vad är en sovjet

Ctss gene

för totalförsvar och samhällets säkerhet (CTSS) vid Försvarshögskolan. Den första är från ekonomen Gene Ambrico, Bank of Finland, som  Single gene/single phenotype association.

Februari 2015 - idag·Singapore.
Bus manhattan

Ctss gene hundhalsband med namn
universitets och högskolerådet kontakt
när ökar inflationen
varför äter man stark mat i varma länder
tillverka egna tröjor
rakna ut med moms
tandskoterskeutbildning boras

Lediga jobb Planerare och utredare m.fl. Uppsala

IDs. MGI:107341 NCBI Gene : 13040. Gene Overview Biological context of CTSS The frequency of the CTSS -25A allele was 0.457 in Caucasians and 0.431 in Canadian Inuit. Because of the importance of the CTSS gene product in vascular matrix remodeling, this polymorphism may be useful in the study of associations with atherosclerosis and related phenotypes. To examine the functional ramifications associated with greater Ctss expression, the Ctss gene was deleted in the mdx genetic background, resulting in protection from muscular dystrophy pathogenesis that included reduced myofiber turnover and histopathology, reduced fibrosis, and improved running capacity.


Tingsrätten malmö kontakt
kommuner varmland

Historia av CP / CMS - History of CP/CMS - qaz.wiki

(1995) became cathepsin K. The cathepsin K cDNA produces a single 1.7-kb transcript as detected on Northern blots of 15-day-old monocyte-derived macrophage RNA, but was not expressed in human monocytes or alveolar macrophages. Gene: Ctss ENSMUSG00000038642 Gene Synonyms.

Ridgeview Podcast: CME Series – Lyssna här – Podtail

These mutations are displayed at the amino acid level across the full length of the gene by default. Restrict the view to a region of the gene by dragging across the histogram to highlight the region of interest, or by using the sliders in the filters panel to the left. Thiol protease. Key protease responsible for the removal of the invariant chain from MHC class II molecules and MHC class II antigen presentation (PubMed:30612035). The bond-specificity of this proteinase is in part similar to the specificities of cathepsin L. Thiol protease. Key protease responsible for the removal of the invariant chain from MHC class II molecules and MHC class II antigen presentation. The bond-specificity of this proteinase is in part similar to the specificities of cathepsin L. 2020-05-12 2020-07-01 2019-07-02 CTSC (Cathepsin C) is a Protein Coding gene.

Symbol status. Approved.